EST 1765374 is a singleton


Sequence

>1765374 (1 EST) Length=290 GATATTCAAAGGATTGTTATTTTGAAAAGATAACTTCAATTGAAAACAAACATACGAATTGGACGATTTTCACCGGTGTA CAGGAGTGATACGATATATGAAATGCAAAAAAGACAATTGCAATAATGATTGATTTCGGTACACAACAATTCTTCATGTT GTTCTGTACAGTGGGCGTCCAGGGTAATTGGGGGGGGGAACCATAGTTACACACAATACTTAGTCCGTATGGGAAATTCG GACAATCCGGGAGGGCAAATCCAACATCCGTAGTGTCCTCCCAAAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765374: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653743241781AI026167MEEG0403.M1FSchistosoma mansoni, egg stage


Date: 23:18:31 on Sun 19 Nov 117.