EST 1765378 is a singleton


Sequence

>1765378 (1 EST) Length=526 AAAACTTCATAAAGCTGCATTGCAATTATGCCATGTAGGCCTACCTATTGGTATTCGCCCCATAATATATGATAATAATA GTAATACTACTACTAATAATAACACCAATACTACTGATAGCGAAATAAAACTTGACCCAAATCCAGATCTAAACCAATGC ATCAAAGTTAATATCACCATCATCATCATCATCAACATCACCTACAACGAAGAAACAATTTAGTGGTTTTGCCCACATAT TCTTATTTCTTCACTGATCGTCATCCTTCAGAATTGCATAACAATTACATTGATTCAACTGCAGCCGCCTTATCCTAGTA ATAGCACCCTCTTTCTTTTGTTTATTTTTTTGCTCTGTTTAACTGTAGACTCTTCTCTTTTTTTCTAGTGAAAGAAATAT GTTTACTTCACTATTCCTTCCTGTTTTTTTTTCAAGTATTTATGAATAAGACAGATGAATTGGTATGTTTATTACTACTG CTGCCACCACCACTAAGGGGGGTACTTTTCCAGCCCCCAAAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765378: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653783241785AI026171MEEG0407.M1FSchistosoma mansoni, egg stage


Date: 17:2:44 on Wed 22 Nov 117.