EST 1765382 is a singleton


Sequence

>1765382 (1 EST) Length=228 ATTATACGTAAGTTTTATTTATACAAACAAATTATCTTAGAATACATAAATAAATACATATATGAATTAGGATAATACTT TATACACATATATCAGTCATTACAACATCTTCCAATGTATTACAAATTTGGTTTAGTTAAAAGATTTCGGCATATGCTCA AAGCCAGATTCCAATGAGATAATGAAATTGTGGAATCTTTGAAAAACACCCGGAAAATTCCCCAGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765382: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653823241789AI026175MEEG0411.M1FSchistosoma mansoni, egg stage


Date: 20:14:16 on Sat 18 Nov 117.