EST 1765383 is a singleton


Sequence

>1765383 (1 EST) Length=289 CAATAACACAAAAATTTTCAATTCATGGGTGCAATGCTAAACATTCAATTCCCAGGGGAGAATCAAGCAGAAATTAACAT GTAAACAACAAGAAGGGCTATCCATGTAAGTTTAACCACCAACTGTAAAGTACACCAAAATGAACGCAAATACAAAGATT ACCGTAGCAATAAATAAAACAATTAACATATAACACACAACTAAATTCATCCCTCTTGAAACCCTATCCATTTAATTTTT AATGTGACTTTTATTTATGATCATGAAAAGAATCTGATGTACAAAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765383: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653833241790AI026176MEEG0412.M1FSchistosoma mansoni, egg stage


Date: 10:1:3 on Wed 22 Nov 117.