EST 1765388 is a singleton


Sequence

>1765388 (1 EST) Length=355 TCAGCGAGTCAGCGAGGGGCAGTCGCCGGAATTAGAAAAAAAAAAGTGTCCTGGTACCTGGTCCCGCCGCCTTTCCCTGC TCCAATTTTGTTCATCAGAAAAGAAAAGAGGGGAGGAAAAAAGAAAAAAAAAGTTATGGTTTGCAACGTCACCCGAAATT AGTTGCGGAACCCGTGTGGCCGTGCTTAAGGTGTGCCAATGTGAGGAGTTGTCAAGCTGGCGCTGTTTTAAAACACCTTT ATTCAGTTTAAAGCGGGAGCCCGTGTTTATTGGCGATTCTCCGTGATTACTCTGCCAGTAAATTTTGCGCATTCCCTGAA TTTGTAAAGCAATAGGAGGTTTACTATTATTGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765388: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653883241795AI026181MEEG0417.M1FSchistosoma mansoni, egg stage


Date: 10:5:33 on Fri 24 Nov 117.