EST 1765390 is a singleton


Sequence

>1765390 (1 EST) Length=195 CGAATTCGGCGAACTTCGTGCGACTTCTCGGACCCTCAACCCCGTGAATGCTATCGATATGAATTTTGGAGGTAGTGATG ATCCTGATATGCGTCTTTGCACGAACGCTTATATGCTTGTGTATATCGCAGATTCCCCCTAAAGAATTTGTTCTATGCCC TGTTTCCGAGATAGAAATTCCTGAGAAATTAAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765390: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653903241797AI026183MEEG0419.M1FSchistosoma mansoni, egg stage


Date: 4:38:39 on Sat 25 Nov 117.