EST 1765391 is a singleton


Sequence

>1765391 (1 EST) Length=216 GAAGAAGAAGAAGATAATGACATTCATTGAATACTTAATCTGTACAAATAAGATAAACTGTTTTTTATCGTTAACTGAAC AAAAGACATAACCAAATGAAACAAACACAATCAATCAAAACTGTACACAATACGAAACTAAACATAAACGTATACAAACT TTTTTGAAACCAACAGTAATGAGTAATAAGCTATGCCCAAATGAAAAAATATATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765391: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653913241798AI026184MEEG0420.M1FSchistosoma mansoni, egg stage


Date: 6:59:57 on Tue 21 Nov 117.