EST 1765392 is a singleton


Sequence

>1765392 (1 EST) Length=208 AACTAACCATACAAGTCTTTTGCTTGTAATATGGCTTCTGATTTTGAGTTTTCACTGATTTGTGTGTGTATCTGTGTATC TTGTATATTTTTCCTGTTTTTTTTCTTTTTATTTCTTTCCTTCCTTTTTTTTTTTCCTTTTTTTGAGAAAGGGTTTCTCT GTAGTTTTGACCCATGTTCTGGAACCCCCTCTTGAGACCAGGTTGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765392: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653923241799AI026185MEEG0421.M1FSchistosoma mansoni, egg stage


Date: 16:54:53 on Wed 22 Nov 117.