EST 1765398 is a singleton


Sequence

>1765398 (1 EST) Length=348 ATTGGGTACCCGGGCCCCCCCTGAAGAAGGTGGAGATTGGGACAGACGAAATCGACTTAAAGTTTACCCGTGGTTTATAT ACTATGTCAGTCCGAGATTTCGATGCTGCTGCTAAGAATTTCCTTGATGCAGTCGCCACATTTACTAGTTATGAGTTAAT GGATTACCCCAACATCCATCATATATACAGTTATGTCTGCGATGATTGCACTTAAACGCCCGGATCTTCGGAAAAAGGTT GTTCGTGGATCAACAATTCAAGAAGTTCTGCATGGATTACCTACTGTACGTGAATATCTCATGTCCCTATTTGATTGTCG TTATGCTGACTTCTTCCTTTCACTCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765398: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653983241805AI026191MEEG0427.M1FSchistosoma mansoni, egg stage


Date: 9:40:7 on Thu 23 Nov 117.