EST 1765401 is a singleton


Sequence

>1765401 (1 EST) Length=158 CTTACTCCCTAGTTGTTGAGTGCGTACAAACCAGCGCTGTAATTCTCTTGTAATTCTCCCCCTCGTCAAACATGACAGGC TCGAACCGGCCTGGTCCGCGNTCTGTNCACTGATATTCTGAAATCCCATCTCTCTAAAAGAAAGAAACAAACACGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765401: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654013241808AI026194MEEG0430.M1FSchistosoma mansoni, egg stage


Date: 0:45:58 on Wed 22 Nov 117.