EST 1765404 is a singleton


Sequence

>1765404 (1 EST) Length=252 ATAATTATATTAATTTTATTACATATATTTCTCTTGTGATGGTTTATATGGTCCAATTTTTTTCACTGCAGTTTTATGAA TACTACCCAATAAATAAGGATTGTAACGAGGAATATGTGAACGTTTAACTCGTTTTTTAGCTACCAGCCTTTTACGACTT TCTCCTCGTAGATATGGATTTACCAAGAAAATTTTCCCATCAGGTCTTTGGCCCCGGGACAAAATCAGGTTTTATGTCCA TTTTCAATTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765404: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654043241811AI026197MEEG0433.M1FSchistosoma mansoni, egg stage


Date: 1:21:27 on Mon 20 Nov 117.