EST 1765405 is a singleton


Sequence

>1765405 (1 EST) Length=196 TTCATAGAATTACTCTGCACCTAGAGTTATTGTCACTGAACTATTTGAAGTATGAAGTTTTTAGTTTATATCTTAAAAAC GTTCATGGCCTGAGTAGTTGTTATCTAATTCCTTTTAAAACTTTTATCATAGGTGAATGGNATTTTANNTTGGGTTTATT GCACTTCATGCTGCCTGTCAAGCTGGACATTTAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765405: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654053241812AI026198MEEG0434.M1FSchistosoma mansoni, egg stage


Date: 22:5:36 on Fri 17 Nov 117.