EST 1765407 is a singleton


Sequence

>1765407 (1 EST) Length=186 TCAAAGTAAAATAGTACTTTATCAATCTAAACATAAATAAACAAAATAAAAGCTATTGAAGAAAGAAAGACAATACAAAA CAGATGTAACTGTAAAATTTTGGACAAGTAAAAAAACTTCAAACCTTTGAAAAAAAGAGGGACGTTAAAAAAGAGCCGAA TAAAAAAAAAATTTCATTTCAGAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765407: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654073241814AI026200MEEG0436.M1FSchistosoma mansoni, egg stage


Date: 23:0:20 on Wed 22 Nov 117.