EST 1765408 is a singleton


Sequence

>1765408 (1 EST) Length=159 AAACATCTAAGATTTTACTTATTCTATGCAAAAAAAAAAATCTATGCCAAATACAATGAGAACCATCATAGTAAAGAAAC CGTAACAGGAAAATATATAAACATGAAGTAAATAAANACTCTGAAATTATTCCAATAATAACAGAAAAGGAATTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765408: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654083241815AI026201MEEG0437.M1FSchistosoma mansoni, egg stage


Date: 17:13:6 on Wed 22 Nov 117.