EST 1765409 is a singleton


Sequence

>1765409 (1 EST) Length=360 CTCGAGGTGTTCTAGGGACCTCAGCACAAGGATGAAGACCTGAGCACTTCATTCTCACTGAACGAAAGACAAAGGGACTG AAGTTTGTAGCACCAGGTAGTGAAGAGTCATGGGGATTTACTTTAGGACCCCTTGTGACTCANNATCTGTTAACCGTGTG TGGATTGAATGGGGCTCCCTAATTCAAGCTCAGCACAACGCCTGGGAGCTGTACACTGACAANTGCTAAACCCTTGACAA GGCTGGTGACCATGNTCCTGACACAGGTGACAAAGCCTTCTGTGCACCAGGGGTTTGGTGGCACCCCAGAGAAGCCACAC GTGTGCCCCGGGCTACAGATCCTTGCCAACTGGCTGGACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765409: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654093241816AI026202MEEG0438.M1FSchistosoma mansoni, egg stage


Date: 23:41:27 on Fri 17 Nov 117.