EST 1765411 is a singleton


Sequence

>1765411 (1 EST) Length=203 ACTAGAATAAAATATATTTATATATATNNNGGTGAATTGATTAAAATTGCAATCCCCTTTCGGTTTTGATAATTTGATGA AAAGTGAACTGAACGTACAACCAAACCAAGGGACAAACAAACGAACGAAAAACCGGACAAATGTTACATTCACAATTACA TTTTCTCATATTGTGCACTCAAAGTATACACACTCAATTATNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765411: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654113241818AI026204MEEG0440.M1FSchistosoma mansoni, egg stage


Date: 4:38:25 on Wed 22 Nov 117.