EST 1765417 is a singleton


Sequence

>1765417 (1 EST) Length=163 TATAAAGATGACTCAGATTTTATGGAGAAATATAGTTGTTCAAAAGTTGACCTAAAGAAATTCTTTGGTGTTTTTATAGG AGATGTGTAGTATCATTAACGTTGCAAAAAATGTAAAGACCGTTTTTGTTCGGAGTTCTTTCTTCGTCGTGATAGGGCTT TCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765417: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654173241824AI026210MEEG0446.M1FSchistosoma mansoni, egg stage


Date: 15:36:28 on Fri 24 Nov 117.