EST 1765423 is a singleton


Sequence

>1765423 (1 EST) Length=472 AATTATAGTACATGTATATGTATTTGGGTATATTTCTTTGCAATACAACATCAAATAACTCAAAGTTGGACATAATAAAT AAACTAATTGATATTCAACACTAAGATTAATGTTTCAATCCATTTTGTTTAATGTTTTCTTTTGTTTGATTGTAGTATAA CGTTGCTAAATTGTTTTAACCTTTTGGTGTACGCCATAATAAAAAGATATATGGTCCATATTTAAAATGAAGTGCTTTAA ATGGTTCATGTGAAAAATTCATACAATATGATCCATTTAATATAACTACTTGCCATACACGATCATATGTTTCATCTAAA TATTGTTTTAATTTATTTGAGATTTCTTTAGTTTCCGGTTGTTTAAATTCTTTTAAATCACCTATCAGTTCACGAACATG TTCAGTAATATCCTATTCAGCTTGGGGTGACATTTTAGATAAAATAATTTCCAAATCTTTTGGAAANTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765423: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654233241830AI026216MEEG0453.M1FSchistosoma mansoni, egg stage


Date: 19:19:33 on Thu 23 Nov 117.