EST 1765427 is a singleton


Sequence

>1765427 (1 EST) Length=370 AGCCTTGCCAAGGGGCCTTGAAGTTTAAGGGAGGCGGAAGGACATAGGTTCTGAGCTTATTTTCCTGAGTTGTATGTTCT GGGTCCTTCTTCTACCATCTCATCTAAAGACAGCTGAAATGACTTGTTGCCATGGCAATCCAGTGCTTTCCCCTCTGCGC CCCGCGAGCTTGCTTGCCTTTGGCGCTCCTAATTCGTAAAGGCTCACTTAAATCGTAAGAGGCAGTGAAATGGACAGATT GAGAATGAGGTCAAGCCTGAATCAAACTGAAGAACTGGCAAATCCCTGGTCCCAACAATGACTTGTGCTTGAATCTTCAG GTTGGAAATCCAGCCTAAACCTTTATCACTGAACAGAGTTATTATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765427: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654273241834AI026220MEEG0457.M1FSchistosoma mansoni, egg stage


Date: 8:35:51 on Fri 24 Nov 117.