EST 1765428 is a singleton


Sequence

>1765428 (1 EST) Length=125 GATAGGTTTGCCTTTGTATGTAACTTGGCCTTTTTCTTTAGCTGCTCTTAATATTTTTTCTTTACTCTGTAGGTTTGATG TTTTGATTATAAATATGGTGAGGTGATTTCTTTTTCTGGTCCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765428: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654283241835AI026221MEEG0458.M1FSchistosoma mansoni, egg stage


Date: 12:34:47 on Fri 17 Nov 117.