EST 1765429 is a singleton


Sequence

>1765429 (1 EST) Length=228 GAATGCTGAATGTTTTTTTTTTGTTTTATTGAAAAAGAATTATGTAAATAGCTAAGTTCATTATAACAGAAACACAGCGA GAAAGATCACGTCAATGCACAAAGTTCATTAGCTCTAGTTAAATTGAATCATAGAGAGAAACAAGTAGAACATAATATTC AATATAGGGAAATTTAAAGAAACTGAAAGATTTTAATCACAAAATGAGTGTCTTCTGTAAACACTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765429: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654293241836AI026222MEEG0459.M1FSchistosoma mansoni, egg stage


Date: 8:20:20 on Wed 22 Nov 117.