EST 1765431 is a singleton


Sequence

>1765431 (1 EST) Length=260 AAAGGTGGGTTCTCAGTTCATTAAGTTATTAAAAGGTTGATCACTAGAGGGAAGGGAGGAGTCTGATGATAAGCTAAGTT TGTGAATAACCTGTTTATCTTAGGTAAATGTGTGTGTGGGGACTAATTTAGGAACACTGGAAGAAAAGTTCTTCCCTTTG TTTCTTTCATATTTCTTAGAGATGCAACATAGGGCCTGTGTCATGCTAGGCGAGAAATTTACTACTTGGTTTTTAAAGAC AATGTCTTGTGTGCAAGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765431: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17654313241838AI026224MEEG0461.M1FSchistosoma mansoni, egg stage


Date: 21:39:59 on Fri 17 Nov 117.