EST 1765580 is a singleton


Sequence

>1765580 (1 EST) Length=264 GGCGGTGTCTTCATCCTCCTCATGATGAAACCCCAAAAGTTCGGGAGGCCACATCTATTGCCAGCAATGATGATAAGTCA AAAGAAAAAAGTTATAAAATAATTGTCGCAGCCGTGAGGCGTCAAAAAGCGTCAGTAAAAGTCCCAAATGTCCCACATTA AATTACAAAGTCTCATTATTTTTATTTTTCCGTCGTGGTATTGGTGCAGCCGATAAAGATGATGTCCCTTACCTCCGTTT CTGTGTTTACCCGTCTGATTTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765580: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17655803244198AI026372TENU0583T. cruzi epimastigote normalized cDNA Library


Date: 19:17:50 on Fri 24 Nov 117.