EST 1765585 is a singleton


Sequence

>1765585 (1 EST) Length=304 AATTAATTACACGTAAATGCATGTATTATACGCATGAAAATGTGACACATCATTGAACCCTTTCACACCCTAATCGTTCT GCTTTCCACCATTCGGCATGGAAGGCTTTTCCTTCTCTTTCTCCTTATCGGTGATGCGATCATGGCCGGTCAATTTCCTA AACTCACCCAGTTTCCTCGTTTCATCTGGAACGCCAAAAAGCGCGGTTCAAAGAGAATCGACTTTCCAGACAACGCTGCT GTGATTTTGGTAGCATTCGATTAACCGTTTCGTTGTGTGATGCCGGCACGAATAATGTACTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765585: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17655853244203AI026377TENU0588T. cruzi epimastigote normalized cDNA Library


Date: 19:52:0 on Fri 17 Nov 117.