EST 1765592 is a singleton


Sequence

>1765592 (1 EST) Length=277 GTATGTATTTATATATACTCATTTTTTGTTGAGTGAATAAATAAGTAGAGAAAACAAAACACAAAAAACAAAACCATGCC ACTTGTGTGTAAATCCTTCAAGAAAGGGGCTTCTGCGCCTAGTCAAACAGACCAAAGCCCATATCGTCGTCTTCCTATAT TTCGCAAAGGATCGCTGGCCTTGCTTTCGCAGTCTCGATTCGTACTGGGAAATCGTTAATCAAGCAAGCTTTTACGCTTG TGTTCTACGTGAGATTTCTGTTCCCACTGAGCTCGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1765592: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17655923244210AI026384TENU0595T. cruzi epimastigote normalized cDNA Library


Date: 0:43:6 on Thu 23 Nov 117.