EST 1765603 is a singleton


Sequence

>1765603 (1 EST) Length=335 GATGCAAGGTGCCGGGCCCAGGGGGCCTGTGGCTGGAGCAAAAAACTGCTCGTATACTGGCGAGGCGCTACTTTGAGAGG TGGCTTGACGCACATCGGTGGTGTAGACTTCCCCTTATGCGTCTGAAGGCGTTAGATGCGTTGCGAGCGAAGTTGTCTCG CGGATTGGCGCGTTCTTTTTTGAGGGCATGGCAAGATTTTGTTCGGAATCGATGTGAACGACGTCGTGTTCTTCGTCTTA TTCCCCATTTGCATCACGCAAACCTCGCCGCATTGGCGCGACGTTACTTTTCTCGCCTCTATGCTTTTCGGTTTGTACGC CGCGATGCACGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765603: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656033244221AI026395TENU0606T. cruzi epimastigote normalized cDNA Library


Date: 14:12:16 on Sat 18 Nov 117.