EST 1765614 is a singleton


Sequence

>1765614 (1 EST) Length=249 AAATCCTTCTTTTTTTATTGTTTTTGTGTTTTCCCAAATAAGTTCGATTGCTCACACTGCGTTAACACCCACCCCCAGGT CCCATTGCGTTATAACTGTATCCCAGCAGGACGCGGCTGGCCCAGGCGCTGTTTGATGCCGCCAGCCCTGTGCCCACAAA AAAAAAAATAAAAAAATAAAAAAAAATAAAAATAAAATCCTGTGAGGGAATTATTGCCGTCTCCTGGCTTACTCCGATAA TACAGGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1765614: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656143244232AI026406TENU0617T. cruzi epimastigote normalized cDNA Library


Date: 0:8:56 on Thu 23 Nov 117.