EST 1765616 is a singleton


Sequence

>1765616 (1 EST) Length=327 ATGACGTCTTCGAAAACCTCTCGTGCTGCGTTCATGAGCCCCTCACGCGCCGCATTCACATCCACGCCCCCATCGAGCTC CGCAACCTGTGGAATGACTTGTTGTAGAAGTGCTGCGTATAGCACTTCGGCTAGTGTACTACAACCAGAACGTTCTTGAC GTAAAAGAAGAGCTTCTATTTTTTCATTATGCTGCTGGGCGACTTCGCGGACAAGAGACTGAAGAGCGGACGGCTTCTCA AATTCCTCTTCCTTGCCATCGCACCCTTGATCATCCACCCCAGAATCAGAAAGGATCAAAGGTAGCAACAACAACTCCAA AAAAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765616: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656163244234AI026408TENU0619T. cruzi epimastigote normalized cDNA Library


Date: 14:11:16 on Mon 20 Nov 117.