EST 1765624 is a singleton


Sequence

>1765624 (1 EST) Length=261 ACACCTCCCCCTCTTTTCCAATCCAATGCAATCTTATCCCTCCGTGCCACACGCACCAGTGGCGTTACGCAGGCAGTGAA GTGATTGTCACACCCCAACAAAACCGACGTTGGGCTCAAAACAGATGTAACTTTTCTCCTCAGGACGTCGTCAAAAGTGA CGCACTGCCGCCTTCTCCGGCAGTCTCGCCTCCTTCACGAGACCCCAAAGAGGTCCCTCCCTCTTTTGTCTCCTTTGCTT CTTCCCTTGACGGTTGTGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765624: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656243244242AI026416TENU0627T. cruzi epimastigote normalized cDNA Library


Date: 19:22:19 on Fri 24 Nov 117.