EST 1765626 is a singleton


Sequence

>1765626 (1 EST) Length=307 CCACTTAAGAGTCATAAAAAAATACATATTTTTTTTTTTATTTTGAAAAAACAAAACAAAACAATAAAAATATAAGAAAA CACGAGGGCGTAGATCAATGCCCGATGAATCGTGATGCTTACCATCTCATGCGGTGGGGCGCATCACCCGGCTTGATGGT GAACACGGAGTGGAGGTATCCGGCCTTTTCCTTCCCGAGCGGGTCCTTCCTGATCGCCTCAATGAGGGCAGCATCAACCT TCTTCTGCAGCTGCGCACGGGCATCACTGACGATTCCCTTCGGTGCCGCCTTCGCCGTCTTTTTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1765626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656263244244AI026418TENU0629T. cruzi epimastigote normalized cDNA Library


Date: 14:57:51 on Wed 22 Nov 117.