EST 1765635 is a singleton


Sequence

>1765635 (1 EST) Length=281 AAAGGCACCAAAAGCACACACGCACAAACACAAACAGGGACCGAAAAACAAACAAACAAACAAAAACAGATATATGGAAG AGTCCCCTCCCCCAAAGCAAAGAAAAACAACAACAACATCAAAAAGAAACGTTCCTCGCTTGCTCCTTCTGCACTCACAA TTATATATACATTTCTCCTCCCTCCCCTCCCCTGTTCAGAGCTTCATGTGTTTCTCGCGATTCATCTAAATACGTTACCG AATATAATATTAAATGTAATCATATGAAAAAAATAGAGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765635: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656353244253AI026427TENU0638T. cruzi epimastigote normalized cDNA Library


Date: 4:35:31 on Wed 22 Nov 117.