EST 1765636 is a singleton


Sequence

>1765636 (1 EST) Length=285 AGATGCACACACCTCTCATTGTGGCACAGGATCCAATGGAGCAGAGAACACCTCGTAAACTCTTTCCTTCATAAATATCT GATGCAACTCCGCATCTAGGCTGGCCACCGGACGTGCTGGACGTCCCTCGTAAACAACATAAGGCGCAAGCTCATCCCAG AGGGCACAACACATCCCGAACGCAGCCACACGCCATCAGGGACCTCCACCCACTCCCCAATGACACAGTCGTCCTCAACA TGCACGTAGCTTCCTACTGACTTTGCTTCACACACTGTTCGTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1765636: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656363244254AI026428TENU0639T. cruzi epimastigote normalized cDNA Library


Date: 4:35:37 on Thu 23 Nov 117.