EST 1765649 is a singleton


Sequence

>1765649 (1 EST) Length=311 GTTGTTTCTTCTCACTTCGGAGGAGTGGATCAAAAACGGCACAAGTAACGTTAATGACAACAAATAACGCGTTAAACGAC TTCCGCATTCCCTATTCTCACACAGAGTAAAGGCGTGTTTGTTTCTGTGTGAAACAAACCCGAAAGAATAACTCACACAC ACGCACACACAAAAGAAGAAAAAAAAAAAAAGAGGACACCAACACTTCTTTATGGCCCAAGCAATTTTAATTCACTCTTC GTTTACGTTTCTTCCTTCAGTTGCCTTTGCAGTATGACGAGAAACAGAGATGACGGAAGAAAAAAGTGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765649: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656493244267AI026441TENU0652T. cruzi epimastigote normalized cDNA Library


Date: 16:10:20 on Fri 17 Nov 117.