EST 1765658 is a singleton


Sequence

>1765658 (1 EST) Length=175 CATCACAAACGATGACCCCCTACCCCACTCACGCCGAAAAGCCGGGCCGCTCCACGCCCTCAAGAAATTTGCTCCGGGAC GTTANAAACGCATGCGGTTTGAGCTCTTCATCCGATCGGNCCCTGTTCACTCTCCCCGACGGAGAAAGAGAAGAAAAAAA AATAAAAACAACCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765658: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656583244276AI026450TENU0661T. cruzi epimastigote normalized cDNA Library


Date: 13:53:39 on Mon 20 Nov 117.