EST 1765660 is a singleton


Sequence

>1765660 (1 EST) Length=254 AAACATGCAGATGAGTAAATACATCTAAATGCGTCTTATACCGTTTTATCGCAACAACAAGAAAAAATAATAATAATACT AATATTAACAATAAGGGGAATCGTAATCGCTTAAAAAAAAACCAAGAAATACGCTGCAAGAGGAGCGTCACTGTCAACCC ACTCAGAGGTTTTTAGGCACTAGGGAAGTTGCAGGTTACGCACCATTGTGAACGTGCCTCCCATAGACAACTCTGTGGCG TCTCGCTTAATCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656603244278AI026452TENU0663T. cruzi epimastigote normalized cDNA Library


Date: 12:25:14 on Fri 17 Nov 117.