EST 1765669 is a singleton


Sequence

>1765669 (1 EST) Length=196 CACAGCCCTGCTAAAAACAAATGCACACAGACACACGCAAAAAGAGAGGGAGAGACAAACAAACAGAAACAGAGCAAAAA AAAGCTAAACAATTTCACACGCGACCGATACGATGGGACACTTCTTGAACCTCGCGCTCCTTGTCAGAAACGCGCTGTCT GTAATGTTCACGTGCTGCGTCACAGGCAGGACACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765669: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656693244287AI026461TENU0673T. cruzi epimastigote normalized cDNA Library


Date: 1:47:28 on Sat 18 Nov 117.