EST 1765678 is a singleton


Sequence

>1765678 (1 EST) Length=299 AAAAAATCCTTCCACCATTCAAAAAGACTCAAACAATTCACGCGCTCATTCAATTCACCGGCCTTCAAACTCCCCTCCGT TCTTTTTTTTTTCCTTCTTTTTTTCCTCTCTCTTTTTAACTCTTTCGTTCTTTGTTTCTTGTCGTTGCTGATCTCCCTCC TTCCTNCCTCCGTCCTACCACCTTCGCAAAGGCCTCACATGGGAAAGCGCAAGATTCCGCAAACTGCAACTCAACGCACC CACATGTCTTTACATGTACTTTCGTACCGGCCAAAAGCAAATGATACGCNCCTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765678: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656783244296AI026470TENU0682T. cruzi epimastigote normalized cDNA Library


Date: 19:33:23 on Sun 19 Nov 117.