EST 1765684 is a singleton


Sequence

>1765684 (1 EST) Length=270 AGAAGCTGTTGTTGTTTATGTTTTAAAATTGCAACGTGTTACGTATACATANAGGTGAGAGGAAAGATAAGCTCGTGTAC ATTGCTGTGTGTTTAGCGTGACATTTCATTGTATGCCATTTGACGTTGAAAATGAAAGCATTCGATGAGTAGGTCCATTG CTGCCTTGGTGCTGCTGAAGTTCCCGTAGATTTCTTCGTCTGCAGTAGGTTTCAGAGTTTTCGGCATGGNTGGTCCCTTT GAAGTTTTGTCTGCTTAGCCCTCCCATGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656843244302AI026476TENU0688T. cruzi epimastigote normalized cDNA Library


Date: 0:23:6 on Thu 23 Nov 117.