EST 1765700 is a singleton


Sequence

>1765700 (1 EST) Length=241 CATTCGCATCTGCAGACTGTTTCTCCACTGGTTTCATTCATTATTCCTCCACCCTATCTCTTTCTCCCATTTTTACTTGA GCGAAAGGTACTCGCTAAGCTCGGCATGGCGACTGAGAACAAGGTCCGCTGCATGAGACAATTCTTCGCACACGGCGGTG ATTCGCGCGTCCCACGCTTCCAGCACCGATGTATTCTCTGGCCGAGAGAAAATGACCGTCTCTGTTGGTCTGATCGAGAA T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1765700: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657003244318AI026492TENU0704T. cruzi epimastigote normalized cDNA Library


Date: 9:32:8 on Sun 19 Nov 117.