EST 1765703 is a singleton


Sequence

>1765703 (1 EST) Length=128 GTGTGTTTATAACAAACAAACGAACCAAAACAAAAGGAGAAAAAAAAAAAACCCCTTCCCTTTCAATTATTATTCCATAC ATATTTATTAATGTATGCGGGTTTGTCTGTCTGTTTGTATATAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657033244321AI026495TENU0707T. cruzi epimastigote normalized cDNA Library


Date: 0:14:26 on Thu 23 Nov 117.