EST 1765705 is a singleton


Sequence

>1765705 (1 EST) Length=286 GTCCACCTCTCAACACACACACACACACACTACGTAATAAATAAATATATAAATAAATACACGCAGATTCCTCTCTCACC TTCTCCCCGTGGATGTCAACAAATAAACTGGAAAACAGGAAACAAGAAGGACACACTCGGTTCAATGCTGTGTTGGTTCA AGCCACACCTTCAAATAAAAACTGCAAGGGCAAAGACAAGCCCTCTTTATCTTCCCTTCGTGTGGGAAACAAACATGTAC TCCATAAACGGAAAACCCACTTATCCATGTATGATGAACCAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1765705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657053244323AI026497TENU0709T. cruzi epimastigote normalized cDNA Library


Date: 11:9:2 on Sun 19 Nov 117.