EST 1765708 is a singleton


Sequence

>1765708 (1 EST) Length=304 CAGTCACACACACACAAATAAATAAATAAATAAATAAATAACAGAAAAAAAAAAACATCGCATTGTAATGAAAGCGTGCA TGCATCCACCAGCATGCAGAAATATATGTCATAATAGTTTTGCCTTTCGCCCCCCCTTCCCTCCTTCCTCCTCCCATTTC TTATTTTTTTCTTTTCTTTTATTTTTATTTATTTATTTTTTTTCCTTTTGCGCAGTAGACATTTAAAAAAAAATATTCTT CTCTCGTTTTTTTTTTTTTTTTTCCCTTACCCCGNCCCACTCTTCTGAAACAAACAAACAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765708: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657083244326AI026500TENU0712T. cruzi epimastigote normalized cDNA Library


Date: 12:12:33 on Fri 17 Nov 117.