EST 1765719 is a singleton


Sequence

>1765719 (1 EST) Length=311 CGCTTCCATTTAAGGTGCATAAATGTCGTATTAAGAGAAGAAAACAGAAGAGAGAAGAAAAAAAGAGGAAGAAGATGAGA AGAGTGTTTCAGTGAATGTAAACAAGCGTAACAAAACAGCCACAAAACAGACGACATCGCGAGATCAGGCCAAAGAGGGC TGATACGCCCCTTTCGCCCGCACGCGCTCCAACAATTCTTCGACAGGCGCCGTCCGCTTCAACTCCTCAGAAAAAAGCCG CCATTCCTTCGCCGCGTCCGCAAATGAGACAGACTGAAAACTTTTCANAAAGATTTGCACAAAACGCACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657193244337AI026511TENU0723T. cruzi epimastigote normalized cDNA Library


Date: 17:8:30 on Thu 23 Nov 117.