EST 1765726 is a singleton


Sequence

>1765726 (1 EST) Length=308 AGAGATACGCTGCAGCCATCGCGGTTACAGTAGCCGCATGCGAATGCAGGTAGTGAAGACAAAAAAATGAATTTCAACAA ATGCTCGCCACGCTGACGTCAACTTTTCCCCATTTTTTCCCGCTACCCTTTTGTTCCTTCTCTTCGTTCATGATCCCCCT CACTGCCGTCACGGTGGAGCCCCTCACACCCCAACCACAAACAACAGAAAAGAAAAAAAAAAGGAGAGCACTTCTCTTTC ACTCCTGTCGGACGCATTTGGGACAGAAGCACTCAAAGTGCCGTTGCTGACAGAGTGCGCGTCGGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765726: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657263244344AI026518TENU0730T. cruzi epimastigote normalized cDNA Library


Date: 19:7:52 on Thu 23 Nov 117.