EST 1765738 is a singleton


Sequence

>1765738 (1 EST) Length=232 CTCGTATGCTTAAAAAGCCATATGCAAATACGCTCGTATTACTTCTCTGGGCTGCTGCCGGATCCTGAACTTACACATAA ATAAGATAGGACGGGAAGATGGGGGGTGTAATAGAAAGACAGTGGGTTCGCCATATCCTCGTTGTTTCCTCCATACATAT ATATTCGGATGACCAGTATCGTGACACGCTGCGCTCTATTCGGACTGGAAATATTTGTTACTTGCGACGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657383244356AI026530TENU0742T. cruzi epimastigote normalized cDNA Library


Date: 18:27:30 on Sat 18 Nov 117.