EST 1765749 is a singleton


Sequence

>1765749 (1 EST) Length=254 ACCGGAATTCAATCAACACTTATATTTCCACAGAAAAGAAGAAAAAAGAAAAAAAAAGTTTCGAAGGGGTGTAATAATAA TAATAATAATAATTGGAAAAAAAAAGGCTTAGTTATTTATTACCACTAAAGAAAAGAAAAAAAATAATGATAAATAAATA AAAAACAAACACTACGTTAAACAAACCAAACAAAAAAAAAACAAATTTTATATTACGCCCACATATTACGGGCATATTCT ACCTCATCCTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765749: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657493244367AI026541TENU0753T. cruzi epimastigote normalized cDNA Library


Date: 5:47:26 on Sun 19 Nov 117.