EST 1765751 is a singleton


Sequence

>1765751 (1 EST) Length=341 ACTTTTCTTTTTTTTGTGTGTTTCCTCTTTTTTTTTTTCTAAAGTTTTTTTTTTTTTTTTTTGCGAGTCTCTTCACGGTT GTCACTCTCCAAAATAACAATGGTGCCAACACAACGGCAAGACTGCAGGACTTCTACAAAATATTTATTCCCAGAGCCTT TCGTAACTGCGCTGCAACAGGCAGTCGCAGAATACTGCAATGGTAGCGAACGACCTGCGGGTACCGTTGCTTCAGTGTTG TACACAATTGCTTCAGCAATAAGGCCTGGTTTATAGCGAGCGACACAACAAGGTCCGCCGCGGTCAGAGAGTCACCAACA AGAAAAAGCATGTCGCTGGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765751: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657513244369AI026543TENU0755T. cruzi epimastigote normalized cDNA Library


Date: 17:12:59 on Thu 23 Nov 117.