EST 1765754 is a singleton


Sequence

>1765754 (1 EST) Length=250 ACAACCACACAACCAAACAACCACAAAAAAAGAAAAACCCAAAAAATATATATATATATATACGGTTCGTAAAATATAAC TCATTACAAAACACCACATAAATAAATAAATATAGTTATATATATTTATATATACAGTGTGTGTGTGTGTGTGTGTGTCA AATAAAATTGCTGGTTTGAAATATAACTCGCATATAATAATTATAAATGAGATTTGTGGACGCAATGATATGCTTGTGTA TGTGCATGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765754: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657543244372AI026546TENU0758T. cruzi epimastigote normalized cDNA Library


Date: 3:45:54 on Sat 18 Nov 117.