EST 1765762 is a singleton


Sequence

>1765762 (1 EST) Length=277 GCCGCACAATTAACGATTATAGTCAGGCACATCCCTTACCCAGATTTCAGCGAGCAAACAAAGCCAAAAATAATAATAAT AATATATATATATATAGCCTAGCTTAAGCAGCGTATTACTTTATTTATTAATAAAGCTGCAAATTATGCAGAAACAATTG AAAAAGAACACGTCACTCCTCTTCAGTTGGTTTCTCCGCCAAAGTTTCTTTCGCCTCAGCTGCAGGGGTTTCGTTTTCTT CTTCACCGTTGCTGCGTGGACCCGGTGGGAAGTGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765762: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657623244380AI026554TENU0766T. cruzi epimastigote normalized cDNA Library


Date: 13:25:13 on Thu 23 Nov 117.