EST 1765765 is a singleton


Sequence

>1765765 (1 EST) Length=336 GGAGATGTTCAACGCTGAGCACCCGGATGCCGAAATCGCTGCACCAAATATTGACATCGCATCCGCCTTTGCACGCGTTT CAAGGTTGTCGCGTTTATATTCTTTGGCAGGCAATCGACGGCAGAAAAATGATGCTTCCATTGTGTCTTTGGAGGAGCAT GCGCCGGCTGTCGCCATTGTTGCGCCGGAGACCCCTTTGCACATGGAAATGGCAAAGCTTACCCAGCAATCGGTAGAGCA TTTTAACAATACCTCCTCGAACGCTGTGGACAAGGCGAGCGTTGCCTTTCAGAAGTGGACTGAGAAGGAGGAGGAATGGC GGGAGAATTGGGGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765765: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657653244383AI026557TENU0769T. cruzi epimastigote normalized cDNA Library


Date: 10:21:5 on Thu 18 Jan 118.